Redes Sociales

Hola, ¿qué deseas buscar?

Ciencia y Tecnología

La estafa ha sido confirmada: La PCR no detecta el SARS-CoV-2, sino secuencias genéticas endógenas

Necesitamos tu ayuda...
La censura de motores de búsqueda, agencias de publicidad y redes sociales controladas por el establishment está recortando nuestros ingresos. Esto nos está haciendo difícil continuar. Si te parece útil el contenido que publicamos, por favor ten en consideración apoyarnos con una donación económica.



Esta es una traducción automatizada del artículo originalmente publicado en Telegra.ph.

 

Por Jesús García Blanca

Las secuencias genéticas utilizadas en la PCR para detectar el presunto SARS-CoV-2 y para diagnosticar los casos de enfermedad y muerte atribuidos al Covid-19 están presentes en decenas de secuencias del propio genoma humano y en las de un centenar de microbios. Y eso incluye los iniciadores o primers, los fragmentos más extensos tomados al azar de su supuesto “genoma” e incluso los llamados “genes diana” supuestamente específicos del “nuevo coronavirus”. La prueba no tiene ningún valor y todos los resultados “positivos” obtenidos hasta ahora deberían ser científicamente invalidados y comunicados a los afectados; y si han fallecido, a sus familiares. Stephen Bustin, uno de los mayores expertos mundiales en PCR, afirma de hecho que, en determinadas condiciones, ¡cualquiera puede dar positivo!

Lo venimos advirtiendo desde marzo: no se pueden hacer pruebas específicas para un virus sin conocer los componentes del virus que se pretende detectar. Y no se pueden conocer los componentes sin haber aislado/purificado previamente ese virus. Desde entonces seguimos acumulando pruebas de que nadie ha aislado el SARS-CoV-2 y, lo que es más importante, de que nunca se podrá aislar por las razones que explicamos el mes pasado (lea el informe “¿Se puede demostrar que hay virus patógenos?” en nuestra web -www.dsalud.com-). Y en el presente informe vamos a ofrecer nuevos datos que demuestran que la RT-PCR no detecta el llamado SARS-CoV-2 como se conoce, sino fragmentos de ARN humano y de numerosos microbios.

Ya hemos explicado los numerosos problemas que plantea la RT-PCR, reconocidos por organismos o gobiernos como la OMS o los CDC y por prestigiosos expertos internacionales como el Dr. Stephen Bustin que considera que tanto la arbitrariedad a la hora de establecer los criterios de los resultados como la elección del número de ciclos son un sinsentido porque pueden llevar a cualquiera a dar positivo. En este informe vamos a añadir los resultados de una investigación particular que hemos realizado a partir de los datos publicados sobre el supuesto SARS-CoV-2 y sobre los protocolos avalados por la OMS para el uso de la RT-PCR así como los datos correspondientes al resto de los “coronavirus humanos”. Y las conclusiones son gravísimas: ninguno de los siete “coronavirus humanos” ha sido realmente aislado y todas las secuencias de los cebadores de sus respectivas PCR, así como las de un gran número de fragmentos de sus supuestos genomas, se encuentran en distintas zonas del genoma humano y en genomas de bacterias y arqueas, como estos: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacterer , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis y un largo etcétera.

Vamos a explicar paso a paso la investigación que nos ha llevado a tan insólita conclusión.

 

 

¿SE HA AISLADO ALGÚN CORONAVIRUS HUMANO?

Durante la primera quincena de abril, cuando las primeras investigaciones que realizamos indicaron que el SARS-CoV-2 no había sido aislado y dado que quienes afirmaban haberlo hecho se basaban en “aislamientos” de anteriores “coronavirus humanos”, comenzamos a hacer una revisión exhaustiva de esos supuestos aislamientos. En concreto, revisamos los supuestos trabajos de aislamiento de los presuntos coronavirus humanos 229E (que se dice que fue aislado en 1965), OC43 (en 1967), SARS-CoV (en 2003), NL63 (en 2004), HKU1 (en 2005) y MERSCoV (en 2012). Y estos han sido los resultados:

 

Coronavirus 229E

Artículo de referencia: Dorothy Hamre y John Procknow. Un nuevo virus aislado del tracto respiratorio humano. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. 1 de enero de 1966.

Dado que los autores remiten a otros artículos para explicar el método de aislamiento -que denominan Fijación del Complemento-, hemos consultado un artículo de referencia para ese método: el de Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, mayo de 1965. Se trata de un procedimiento ya en desuso que utiliza la reacción antígeno-anticuerpo para detectar uno u otro. En el caso que nos ocupa, se trataba de detectar los antígenos del supuesto nuevo virus pero, como ya hemos explicado, se necesitan anticuerpos específicos que no se pueden obtener la primera vez que se detecta un virus.

Publicidad. Arrastra para seguir leyendo.

 

Coronavirus OC43

Artículo de referencia: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Tesis para el Departamento de Microbiología de la Universidad de Hong Kong, agosto de 2007. El HKU Scholars Hub.

Lo que se consideraba ARN viral se extrajo de los cultivos sin ninguna prueba de que el ARN perteneciera a un virus. La herramienta utilizada -un kit QIAamp- elimina reactivos, inhibidores y contaminantes, pero lo que no puede hacer es determinar de dónde procede el ARN extraído. Y no hay controles. Luego se amplifica por PCR y se secuencia suponiendo (¡!) que se trata de información genética de un virus. Finalmente, el autor especula sobre mutaciones, recombinaciones, genotipos, evolución molecular, cepas y demás jerga que transmite la idea -no probada- de que se está trabajando con un “virus”.

 

Coronavirus SARS-CoV

Artículo de referencia: J. S. M. Peiris y otros. Coronavirus como posible causa del SARS. Lancet 361: 1319-25, abril de 2003.

En el artículo no se menciona la purificación. Ni siquiera se menciona la filtración o la centrifugación. Sólo se afirma que “los virus se aislaron en células de hígado de mono fetal a partir de aspirados nasofaríngeos y biopsias de pulmón de dos pacientes”. No hay controles. Sólo se menciona un “efecto citopático” que se atribuye a un virus y que se hizo una PCR para virus y retrovirus conocidos sin obtener resultados. Finalmente, se hizo la RT-PCR con “iniciadores aleatorios” y se detecta una secuencia “de origen desconocido” a la que se le encuentra “una débil homología con la familia de los coronaviridios”. A continuación, diseñaron cebadores para esa secuencia y, al analizar 44 muestras de pacientes con SARS, sólo 22 resultaron positivas.

 

Coronavirus NL63

Artículo de referencia: Lia van der Hock y otros. Identificación de un nuevo coronavirus humano. Nature Medicine, 10, 4 de abril de 2004.

Los autores afirman que “la identificación de patógenos desconocidos mediante herramientas de biología molecular es difícil porque no se conoce la secuencia diana, por lo que no se pueden diseñar iniciadores específicos para la PCR”. Lo que utilizaron es una herramienta desarrollada por ellos mismos llamada VIDISCA que, según afirman, ¡no requiere un conocimiento previo de la secuencia! ¿Es eso posible? Veamos cómo funciona: primero se prepara el cultivo y se supone que hay un virus por la evidencia del “efecto citopático”. La novedad que introduce este método es que se añaden “enzimas de restricción”, enzimas que cortan las moléculas de ácido nucleico en determinados lugares y siempre por la misma longitud. De esta forma, si tras la acción de estas enzimas observan muchos fragmentos de ADN o ARN iguales o muy parecidos, deducen que procede de un virus, ya que el genoma del huésped presentaría cortes aleatorios, mientras que el genoma del virus presenta un gran número de copias iguales debido a la replicación del virus. ¿Y tal deducción es correcta? Por supuesto que no. Esta suposición (que se suma a la anterior de que existe un virus) no tiene en cuenta que existen “partículas similares a los virus”, “partículas similares a los retrovirus”, “retrovirus endógenos”, “exosomas”, partículas “extracelulares” e incluso ADN mitocondrial. Para negarlo, existen multitud de partículas que poseen las mismas características reproductivas en grandes cantidades que los “virus” y que, por tanto, pueden falsear los resultados al producir un gran número de copias idénticas cuando son cortadas por las enzimas, como se reconoce en un artículo sobre la técnica VIDISCA titulado Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. Se publicó en el volumen 263 de Virus Research el 2 de abril de 2019, y sus autores -Cormac M. Kinsella y otros- reconocen que “no se espera ninguna redundancia en el inserto VIDISCA del ácido nucleico de fondo del huésped, excepto en el caso de características “similares a las de un virus”, es decir, un alto número de copias como en el ADN mitocondrial.”

 

Coronavirus HKU1

Artículo de referencia: Patrick C. Y. Woo y otros. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, enero de 2005.

Publicidad. Arrastra para seguir leyendo.

El artículo, increíblemente, comienza con estas palabras “A pesar de la extensa investigación en pacientes con infecciones del tracto respiratorio, no se ha identificado ninguna causa microbiológica en una proporción significativa de pacientes. El ARN se extrae de cultivos no purificados”. Y se utiliza una PCR con genes de coronavirus. Para la secuenciación utilizan dos bases de datos de proteínas organizadas en familias, dominios y sitios funcionales -PFAM e INterProScan- combinadas con dos programas informáticos que realizan “predicciones” sobre cómo deben combinarse los nucleótidos. El texto añade: “Las secuencias fueron ensambladas y editadas manualmente para producir una secuencia final del genoma viral”. Y una vez más no hay controles.

 

Coronavirus MERS-CoV

Artículo de referencia: Ali Moh Zaki y otros. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, noviembre de 2012.

El material genético se extrae directamente del sobrenadante del cultivo y de la muestra de esputo con una herramienta llamada High Puré Viral Nucleic Acid Kit y luego se prueba con diferentes PCR para varios microorganismos conocidos. No se menciona la purificación y no hay controles. En definitiva, lo que se había hecho con los primeros coronavirus -y con muchos otros supuestos virus- es cultivar tejidos supuestamente infectados -cualquier “efecto citopático” se atribuía únicamente a la presencia de un virus- y luego, o bien se obtienen unas proteínas que sin ninguna prueba se consideran “antígenos de virus” y cuando estos “antígenos” se detectan en los cultivos se interpreta como “aislamiento”, o bien se extraen fragmentos de ácidos nucleicos asumiendo que pertenecen a un virus.

 

Ya explicamos en el artículo publicado en el número anterior de la revista que según el Dr. Stefan Lanka el llamado “efecto citopático” es en realidad un efecto causado por las condiciones (envenenamiento e inanición) del propio cultivo. Así se reconoce, por ejemplo, en el artículo Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA publicado el 15 de agosto de 2017 en la web de Nature y firmado por Andrea Németh y otros (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf) En él se explica que ciertas sustancias -como los antibióticos- añadidas a los experimentos in vitro pueden estresar los cultivos celulares para que generen nuevas secuencias que no se habían detectado previamente. Esto ya había sido advertido nada menos que por la Dra. Barbara McClintock en 1983 durante su conferencia del Premio Nobel, como puede verse en https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.pdf

En esencia, NINGUNO DE LOS SIETE SUPUESTOS CORONAVIROS HUMANOS HA SIDO REALMENTE AISLADO. Lo único que ha sido diferente entre ellos son los procedimientos y técnicas de laboratorio que se fueron sofisticando progresivamente lo que, en este caso, ha implicado no una mayor precisión sino una mayor capacidad de engaño y autoengaño que ha culminado en la virtual fabricación del SARS-CoV-2.

Y la consecuencia obvia de la falta de pruebas de su aislamiento es que tales “coronavirus” no pueden ser considerados responsables de ninguna enfermedad. Además, todas las pruebas -de cualquier tipo- basadas en los presuntos componentes de estos “virus” (ácidos nucleicos o proteínas) quedan totalmente descalificadas como “pruebas de infección” y más aún como “diagnóstico” de enfermedades.

 

 

MÁS PETICIONES SIN RESPUESTA

En el número anterior ya recogimos las respuestas dadas por los autores de varios artículos que supuestamente describían el aislamiento del SARS-CoV-2 en las que reconocían que no habían “purificado” lo que implícitamente significa reconocer que el virus no estaba aislado. Y ahora vamos a añadir una prueba más: las respuestas dadas por diferentes autoridades -políticas y sanitarias- de varios países sobre la purificación y el aislamiento del SARS-CoV-2.

James McCumiskey -autor del libro La última conspiración: El Paradigma Biomédico- cuenta que el Laboratorio Nacional de Referencia de Virus de Irlanda solicitó información al respecto a la Universidad de Dublín y ésta respondió que “no tiene registros que puedan dar respuesta a su petición”. El director de los servicios jurídicos del laboratorio insistió en su petición a la universidad y ésta respondió lo siguiente “La posición de la universidad es que el material de debate académico no puede estar sujeto a la Ley de Libertad de Información”. De la solicitud del NVR se deduce que no han cultivado el SARS-CoV-2 ni lo han purificado. Sólo reconocen haber “detectado ARN de SARS-CoV-2 en muestras de diagnóstico”.

El 22 de junio, un grupo de expertos envió una consulta en términos similares al primer ministro británico Boris Johnson. La carta estaba firmada por el Dr. Kevin Corbett, Piers Corbyn -profesor del Imperial College de Londres-, el ingeniero e investigador independiente -al que entrevistamos en la revista en su momento- David Crowe, el Dr. Andrew Kaufman, el profesor de biología de Edimburgo Roger Watson y el biólogo y químico David Rasnick, ¡y a día de hoy todavía no han recibido respuesta!

Publicidad. Arrastra para seguir leyendo.

Otra petición similar -en este caso al Consejo Nacional de Investigación de Canadá- recibió la siguiente respuesta: “No hemos podido realizar una búsqueda completa en los registros del NRC, por lo que lamentamos informarle de que no se han identificado registros que respondan a su solicitud”. Añadiremos que dos periodistas han enviado solicitudes similares -en virtud de la Ley de Libertad de Información- a varias instituciones de Canadá, Nueva Zelanda, Australia, Alemania, Reino Unido y Estados Unidos, y hasta el 5 de septiembre, doce instituciones han respondido, indicando todas lo mismo: que no tienen ningún registro de trabajos que describan el aislamiento del virus que supuestamente causa el Covid-19. Los detalles y las respuestas pueden verse en https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/

 

 

BUSCANDO EL ORIGEN DEL FALSO GENOMA

La pregunta que nos hicimos entonces fue: si las secuencias que se han publicado no pertenecen -como se afirma- a nuevos virus, ¿de dónde proceden? Y para intentar responder a esa pregunta decidimos realizar una búsqueda con un programa informático llamado Basic Local Alignment Search Tool (BLAST), una herramienta de búsqueda de alineamiento de secuencias que permite comparar una secuencia determinada con todas las secuencias almacenadas en el National Institutes of Health de Estados Unidos (es público y se puede consultar en https://blast.ncbi.nlm.nih.gov/Blast.cgi. Explicamos paso a paso lo que hicimos para que nuestros lectores puedan repetir la búsqueda por sí mismos y comprobar los resultados.

Primero recogimos todos los iniciadores de las PCRs descritas en los protocolos alojados en la web de la OMS en ese momento que eran estos:

  • Protocolo del CDC de China: utiliza los genes ORF1ab y N como objetivo.
  • Protocolo del Instituto Pasteur (Francia): utiliza dos fragmentos del RdRP (que se supone que es específico del SARS.CoV-2).
  • Protocolo de los CDC de Estados Unidos: utiliza tres fragmentos del gen N.
  • Protocolo del Instituto Nacional de Enfermedades Infecciosas de Japón: es el único que tiene como objetivo el gen S junto con otros genes supuestamente compartidos con otros coronavirus.
  • Protocolo de Charite (Alemania): utiliza los genes E, N y RdRP. – Protocolo de la Universidad de Hong Kong: utiliza el ORF1b-nsp14 y el gen N.
  • Protocolo del Instituto Nacional de Salud de Tailandia: utiliza el gen N.

A continuación, introdujimos la secuencia de los cebadores -el que indica el inicio de la secuencia a detectar (forward) y el que indica el final (reverse)- en el BLAST para que pudiera buscarlos en dos bases de datos: una colección de genomas de microbios y la correspondiente al genoma humano.

 

¡LAS SECUENCIAS DEL LLAMADO SARS-COV-2 SE ENCUENTRAN TANTO EN HUMANOS COMO EN NUMEROSOS MICROBIOS!

Veamos en detalle el procedimiento tomando como ejemplo a los iniciadores del protocolo francés. Una vez en el sitio web de BLAST, elegimos Microbes para buscar en las bases de datos de genomas microbianos y pasamos a la página siguiente. Entonces apareció un formulario en el que introdujimos la secuencia del iniciador forward del protocolo francés -es decir, ATGAGCTTAGTCCTGTG-, seleccionamos la opción Highly similar sequences y pulsamos la tecla BLAST. A los pocos segundos aparecieron los resultados -hicimos una captura de pantalla (imagen 1)- y se nos mostraron 100 secuencias de microbios -sobre todo bacterias y arqueas- con una coincidencia de entre el 77% y el 100% con un porcentaje de identidad del 100%.

A continuación volvimos a la página principal y esa segunda vez elegimos Human para buscar el genoma humano, repetimos la misma operación y a los pocos segundos apareció el resultado que volvimos a capturar por pantalla (imagen 2). Y resulta que la secuencia introducida coincide con 74 secuencias del genoma humano, con una coincidencia de entre el 66% y el 100% y un porcentaje de identidad del 100%.

¡Y eso indica que la secuencia de ese cebador de PCR inicial que se supone que es específico para el SARS-CoV-2 corresponde en realidad a 74 fragmentos del genoma humano y a un centenar de fragmentos microbianos también!

Entonces decidimos repetir la operación pero con el cebador final o inverso -que es CTCCCTTTGTGTGT- y los resultados fueron similares.

Como se trataba de secuencias muy cortas -unas veinte letras genéticas o nucleótidos- decidimos volver a intentarlo pero con la secuencia objetivo definida por estos dos cebadores, es decir, la secuencia del supuesto genoma del SARS-CoV-2 que se encuentra entre el cebador inicial y el final. Obviamente, para ello necesitábamos la secuencia que oficialmente se reivindica como “genoma del SARS-CoV-2” y aunque miles de laboratorios afirman haberla aislado y secuenciado -una afirmación falsa como hemos explicado en informes anteriores- decidimos acudir a la web del National Centre for Biotechnology Information: Una vez allí, localizamos la “secuencia objetivo”, un fragmento de 108 nucleótidos situado entre las posiciones 12.690 y 12.797 del “genoma”, que es este

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTCCGGTACACAAACTGCTTGAT GACAATGCGTTAGCTTACAACAAAGGGAG.

Con esto repetimos los pasos anteriormente descritos y los resultados volvieron a ser sorprendentes ya que aparecieron de nuevo un centenar de secuencias de microbios con un porcentaje de coincidencia del 100% y cuatro secuencias del genoma humano con un porcentaje de identidad entre el 83% y el 95%. Las coincidencias fueron por tanto menores pero lo importante es que seguimos encontrando fragmentos de la supuesta “secuencia diana” del SARS-CoV-2 tanto en los microbios como en nuestro propio genoma.

Publicidad. Arrastra para seguir leyendo.

Realmente asombrados dimos un paso más y probamos con el gen considerado en ese momento como el más específico del SARS-CoV-2, el gen E que se supone que genera las proteínas de la envoltura y que se encuentra entre las posiciones 26.245 y 26.472: ATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTGGTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGTGTGTACTGCTGCAATGTTAACGTTTGAGTCTTGTAAAACCTTGTTAAAATGTGTTTAAAATGAATTTCTAGAGTTCG ATTCTGGTCTAA.

Repetimos con él los pasos ya descritos y el resultado fue aún más sorprendente porque a pesar de su longitud aparecieron otras cien secuencias del microbio con un porcentaje de identidad del 100% y 10 secuencias del genoma humano con un porcentaje de identidad entre el 80% y el 100%. Y resultados similares se obtuvieron con un fragmento elegido al azar y con el gen N que dicen que corresponde a las proteínas de la nucleocápside del SARS-CoV-2.

Finalmente, decidimos probar con el gen S, del que se dice que genera las proteínas estructurales “pico” que son clave para la entrada en la célula, y que posteriormente se consideró el gen más específico del SARSCoV-2. Como se trata de un gen cuya secuencia es mucho más larga -3821 nucleótidos entre las posiciones 21.563 y 25.384- probamos con dos fragmentos elegidos al azar dentro de ese gen y el primero -TGGCAAAATTCAAGACTCACTTTC- dio como resultado otro centenar de secuencias de microbios y 93 del genoma humano y el segundo -CTTGCTGCTACTAAATGCAGAGTGT- un centenar de secuencias de microbios y 90 del genoma humano.

Por último, decidimos probar con los iniciadores del Protocolo de Japón, el único que incluye secuencias diana del gen S y, el lector ya lo habrá adivinado, los resultados fueron de nuevo similares: ¡un centenar de secuencias de microbios y 93 del genoma humano con un porcentaje de identidad entre el 94,12% y el 100%!

 

CONCLUSIONES

La consecuencia de todo lo que acabamos de explicar es clara e inmediata: NO HAY NINGUNA PRUEBA VÁLIDA PARA DETECTAR el SARS-COV-2, ni las pruebas de anticuerpos o antígenos ni la RT-PCR. E incluimos las que se basan en el supuesto gen que codifica la proteína S1 o espiga. Y eso significa que TODOS LOS NÚMEROS DE “CASOS”, “INFECTADOS”, “ENFERMOS”, “ASINTOMÁTICOS” O “MUERTOS POR COVID-19” CARECEN DE BASE CIENTÍFICA Y TODOS LOS “POSITIVOS” SON FALSOS POSITIVOS, algo que debería ser comunicado inmediatamente a los afectados y los responsables deberían rendir cuentas.

Terminamos añadiendo que incluso la propia OMS no cree realmente en estas pruebas. Basta con leer el documento publicado el pasado 11 de septiembre como guía de laboratorio para el SRAS-CoV-2 titulado Pruebas de diagnóstico para el SRAS-CoV-2 -está disponible en https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve- y dice literalmente en la página 5: “Siempre que sea posible, la sospecha de infección activa debe analizarse con una prueba de amplificación de ácidos nucleicos (NAAT) como la RT-PCR. Las pruebas NAAT deben dirigirse al genoma del SARS-CoV-2, pero como no se conoce la circulación mundial del SARS-CoV-1, una secuencia de Sarbecovirus (que se supone que incluye al menos cinco coronavirus humanos y animales, incluidos el SARS-CoV-1 y el SARS-Cov-2) también es un objetivo razonable”. Es decir, la OMS está de acuerdo en utilizar secuencias no específicas para detectar el SARS-CoV-2.

Eso no es todo, porque el manual dice más adelante: “Un diagnóstico óptimo consiste en una prueba NAAT con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en las zonas donde la transmisión está muy extendida, se puede utilizar un algoritmo simple de una sola diana”.

El manual de la OMS afirma que “uno o varios resultados negativos no descartan necesariamente la infección por SARSCoV-2. Hay una serie de factores que pueden producir un resultado negativo en un individuo infectado, como la mala calidad de la muestra, la recogida tardía de la misma, la manipulación inadecuada o razones técnicas inherentes a la prueba, como la mutación del virus o la inhibición de la PCR.” ¿Qué esperan los jueces para actuar?

 

Fuente:

Jesús García Blanca / Corona Investigative / Telegra.ph — The scam has been confirmed: PCR does not detect SARS-CoV-2, but endogenous gene sequences.tup

Te puede interesar

Ciencia y Tecnología

Un estudio publicado el 17 de febrero por la revista médica general revisada por pares, The Lancet, concluye que las pruebas PCR que se...

Ciencia y Tecnología

El Departamento de Salud del Estado de Florida ordenó que los laboratorios comuniquen al FDOH “los valores del umbral de ciclo (CT) y sus...

Ciencia y Tecnología

En 2007, The New York Times documentó la historia de una “epidemia” que asustó al personal médico de un hospital de los Estados Unidos...

Ciencia y Tecnología

¿Os acordáis cuando los medios tradicionales no ocultaban información relevante y eran uno de los pilares fundamentales de cualquier democracia que se precie? ¿Recordáis...

Publicidad que es odysee

Archivos

Redes Sociales

Publicidad siguenos en telegram
Publicidad Ledger Live Coinify

Pensar con el corazón

Interactuamos solo con energía e información. Es por ello que, solo con la energía de tu intención, puedes manifestar una realidad que te haga sentir bien aún en medio de este caos sin precedentes en toda la historia humana. Solo tienes que saber cómo funciona la energía de tu corazón y de la conciencia. En este libro lo encontrarás fácilmente explicado con fundamentos científicos.

Pensar con el Corazon